Data

Example structure of a “good” guide

Viral secondary structure

  • Manfredonia et al. NAR (2020)
    • SHAPE-MaP/DMS-MaPseq of in vitro refolded viral genome in ~500bp tiles
    • data: sequences of single-stranded (low Shannon entropy, high SHAPE) regions (3599 nt; 12.0% of genome)
    • per-guide metric: % of target labeled as single-stranded
  • Lan et al. bioRxiv (2020)
    • DMS-MaPseq in infected Vero E6 cells
    • data: coordinates of unstructured/structured regions (6010 nt; 20.1% of genome)
    • per-guide metric: % of target labeled as unstructured
  • Sun et al. Cell (2021)
    • icSHAPE in infected Huh7.5.1 cells & on extracted RNA
    • data: icSHAPE score [0,1] per nucleotide
    • per-guide metric: mean icSHAPE score (higher = more likely to be single-stranded)
  • Huston et al. Molecular Cell (2021)
    • SHAPE-MaP of purified RNA from infected Vero E6 cells
    • data: RNAstructure connectivity table (CT) per nucleotide (12527 positions unbound; 41.9% of genome)
    • per-guide metric: % target labeled as unpaired
## Warning: Removed 35 rows containing non-finite values (stat_density).

## Warning: Removed 35 rows containing non-finite values (stat_density).

Correlation between annotations: over entire spacer target

  • Annotations from Manffedonia (2020) correlate poorly with other annotations
    • Only 12% of genome is labeled
    • Experimental data generated on 500bp tiling of refolded viral genome
  • Relatively high correlation between annotations generated from in vivo settings
    • Lan (2020)
    • Sun (2021)
    • Huston (2021)

Intersection of in vivo viral structure predictions

Correlation between annotations: over spacer seed region (positions 8-12 on spacer)

Exploratory data analysis: controls

Plate controls: 612_Control and No_Protein

  • Plate GS2-2 outliers: O 9-12, 21-24
  • No_Protein (+/- activator) and 612_Control (- activator) controls cluster tightly across plates
  • Variable spread of 612_Control activity with 100 fM activator

No activator controls

## Warning: Removed 1 rows containing non-finite values (stat_ydensity).

  • No activator varies by plate (and presumably by guide)
  • Want to be able to account for additional gain in rate above no activator background
  • Outliers on plate GS2-1 all correspond to NCR_1344

Data analysis

Methods:

  • Mixed linear regression to compute rate per condition across triplicates:
    • per guide: \(\text{signal}_i(t) = (\beta_0 + \beta_{0,i}) + (\beta_{\text{100fM}}\cdot\mathbb{I}[\text{100fM}]) \ + (\beta_{t} + \beta_{t,i}) \cdot t \ + (\beta_{t:\text{100fM}}\cdot t\cdot\mathbb{I}[\text{100fM}])\)
    • no activator: \(\text{signal}_i(t) = (\beta_0 + \beta_{0,i}) + (\beta_t + \beta_{t,i}) \cdot t_i\)
    • 100fM activator: \(\text{signal}_i(t) = (\beta_0 + \beta_{0,i} + \beta_{\text{100fM}}) + (\beta_t + \beta_{t,i} + \beta_{t:\text{100fM}}) \cdot t_i\)
    • 100fM rate above no activator: \(\beta_{t:\text{100fM}}\)
  • Background subtract mean of empty wells
  • Exclude timepoints before 1000 seconds (first 10 timepoints show dip in some no activator controls)
  • Random effects (per 384-well, across timepoints): intercept, slope (wrt time)
  • Fixed effects: intercepts (\(\beta_0\), \(\beta_{\text{100fM}}\)), slopes (\(\beta_t\), \(\beta_{t:\text{100fM}}\))
## [1] "mixed model failed: NCR_1411"

Example traces:

  • dots: signal per 384-well per time
  • solid lines: regression fit

Results: 100 fM rates (above no activator)

Summary of screen

  • Similar spread of rates across plates
  • Expect to see poorer rates for plates GS2-1 and GS2-2 (which harbor the “bad” guides)

Detection at last timepoint

Time to detection

Per guide: * Per timepoint: t-test for difference in signal between no activator and 100 fM conditions per timepoint * Perform FDR correction for number of measurements from start of experiment to timepoint * Return first timepoint for which corrected p-value < 0.05

Volcano plots of screening rates

  • Guides on plate GS2-2 have similar rates as to other plates, but are much more variable (p-values closer to 1)

Rates by position along SARS-CoV-2 genome

Structures of the two guides that performed well (rate > 1 above background) but without hairpin structure (NCR_1346, NCR_1351):

Rates across groups of guide secondary structure

  • Statistically significant (positive?) correlation between guide activity and spacer structure

Determination of how much of predicted hairpin structure needs to be maintained:

##         NCR.id                       spacer
## 120   NCR_1313         GUUUACCUUGGUAAUCAUCU
## 126   NCR_1319         UCAUUAAAUGGUAGGACAGG
## 137   NCR_1330         GCAAUCAAUGGGCAAGCUUU
## 138   NCR_1331         CUUCUCUGUAGCUAGUUGUA
## 139   NCR_1332         GAGUAAAUCUUCAUAAUUAG
## 142   NCR_1335         AUGGUGUCCAGCAAUACGAA
## 143   NCR_1336         GCCGUCUUUGUUAGCACCAU
## 155   NCR_1348         AUUAGCUCUCAGGUUGUCUA
## 156   NCR_1349         UGGUACGUUAAAAGUUGAUG
## 158   NCR_1351         UGGCUACUUUGAUACAAGGU
## 21685 NCR_1410 UGAAUGUAAAACUGAGGAUCUGAAAACU
## 9671  NCR_1412 UAUAAGCAAUUGUUAUCCAGAAAGGUAC
## 10691 NCR_1417 GAUUGAGAAACCACCUGUCUCCAUUUAU
##                                                          structure
## 120           ...((((((((.........))))................))))........
## 126           ...((((((((.........))))................))))........
## 137           .......(((((....(((...((........))..))).))))).......
## 138           ..(((.(((........(((((.........)))))......))).)))...
## 139           ...............(((((((..(((......)))...)))))))......
## 142           ................((..((((((((.....))))))))..)).......
## 143           ..............((((((((((........)))..)))))))........
## 155           (((((.((((......(((.((((............))))))))))))))))
## 156           ...((((((((.........))))........)))).((((((...))))))
## 158           (((.(((((((.........))))........))))))(((((...))))).
## 21685 ((((((.((((.........))))......((.....))........)).))))......
## 9671  ...(((.((((.........))))............(((....))).........)))..
## 10691 ...............(((((((((((......................)))))).)))))

  • “Good” guides exhibit similar 100fM rates as “bad” guides

Rates across guide ordering group

Background (no activator) rate by guide secondary structure

  • In guides that maintain crRNA hairpin: correlation between number of basepaired positions in spacer and background no activator rate

  • No correlation between spacer GC content and guide activity

Comparison of 20mers to 28mers

Guide activity by viral structure

  • Correlation between viral structure as annotated by Lan (2020)
    • But no correlation with other in vivo annotations (Sun and Huston)

k-means clustering of in vivo structures (Lan, Sun, Huston)

Restriction to spacer seed region (positions 8-12 on spacer)

Position regression: guide rate

  • “Unstructured” label from Lan (2020) is most predictive
  • Also informative:
    • Base-paired-ness from Huston (2021) in position 1
    • in vitro icSHAPE score from Sun (2021) in positions 6-9
  • Spacer sequence is most informative in positions 2, 13, 17, 18
## Warning in predict.lm(training_fit, newdata = subset(lan_regression_data, :
## prediction from a rank-deficient fit may be misleading

Likelihood ratio test (spacer-only vs. spacer+structure):

## Likelihood ratio test
## 
## Model 1: rate ~ spacer_1_A + spacer_1_C + spacer_1_G + spacer_1_T + spacer_2_A + 
##     spacer_2_C + spacer_2_G + spacer_2_T + spacer_3_A + spacer_3_C + 
##     spacer_3_G + spacer_3_T + spacer_4_A + spacer_4_C + spacer_4_G + 
##     spacer_4_T + spacer_5_A + spacer_5_C + spacer_5_G + spacer_5_T + 
##     spacer_6_A + spacer_6_C + spacer_6_G + spacer_6_T + spacer_7_A + 
##     spacer_7_C + spacer_7_G + spacer_7_T + spacer_8_A + spacer_8_C + 
##     spacer_8_G + spacer_8_T + spacer_9_A + spacer_9_C + spacer_9_G + 
##     spacer_9_T + spacer_10_A + spacer_10_C + spacer_10_G + spacer_10_T + 
##     spacer_11_A + spacer_11_C + spacer_11_G + spacer_11_T + spacer_12_A + 
##     spacer_12_C + spacer_12_G + spacer_12_T + spacer_13_A + spacer_13_C + 
##     spacer_13_G + spacer_13_T + spacer_14_A + spacer_14_C + spacer_14_G + 
##     spacer_14_T + spacer_15_A + spacer_15_C + spacer_15_G + spacer_15_T + 
##     spacer_16_A + spacer_16_C + spacer_16_G + spacer_16_T + spacer_17_A + 
##     spacer_17_C + spacer_17_G + spacer_17_T + spacer_18_A + spacer_18_C + 
##     spacer_18_G + spacer_18_T + spacer_19_A + spacer_19_C + spacer_19_G + 
##     spacer_19_T + spacer_20_A + spacer_20_C + spacer_20_G + spacer_20_T
## Model 2: rate ~ spacer_1_A + spacer_1_C + spacer_1_G + spacer_1_T + spacer_2_A + 
##     spacer_2_C + spacer_2_G + spacer_2_T + spacer_3_A + spacer_3_C + 
##     spacer_3_G + spacer_3_T + spacer_4_A + spacer_4_C + spacer_4_G + 
##     spacer_4_T + spacer_5_A + spacer_5_C + spacer_5_G + spacer_5_T + 
##     spacer_6_A + spacer_6_C + spacer_6_G + spacer_6_T + spacer_7_A + 
##     spacer_7_C + spacer_7_G + spacer_7_T + spacer_8_A + spacer_8_C + 
##     spacer_8_G + spacer_8_T + spacer_9_A + spacer_9_C + spacer_9_G + 
##     spacer_9_T + spacer_10_A + spacer_10_C + spacer_10_G + spacer_10_T + 
##     spacer_11_A + spacer_11_C + spacer_11_G + spacer_11_T + spacer_12_A + 
##     spacer_12_C + spacer_12_G + spacer_12_T + spacer_13_A + spacer_13_C + 
##     spacer_13_G + spacer_13_T + spacer_14_A + spacer_14_C + spacer_14_G + 
##     spacer_14_T + spacer_15_A + spacer_15_C + spacer_15_G + spacer_15_T + 
##     spacer_16_A + spacer_16_C + spacer_16_G + spacer_16_T + spacer_17_A + 
##     spacer_17_C + spacer_17_G + spacer_17_T + spacer_18_A + spacer_18_C + 
##     spacer_18_G + spacer_18_T + spacer_19_A + spacer_19_C + spacer_19_G + 
##     spacer_19_T + spacer_20_A + spacer_20_C + spacer_20_G + spacer_20_T + 
##     structure_1_. + structure_1_structured + structure_1_unstructured + 
##     structure_2_. + structure_2_both + structure_2_structured + 
##     structure_2_unstructured + structure_3_. + structure_3_both + 
##     structure_3_structured + structure_3_unstructured + structure_4_. + 
##     structure_4_both + structure_4_structured + structure_4_unstructured + 
##     structure_5_. + structure_5_both + structure_5_structured + 
##     structure_5_unstructured + structure_6_. + structure_6_both + 
##     structure_6_structured + structure_6_unstructured + structure_7_. + 
##     structure_7_both + structure_7_structured + structure_7_unstructured + 
##     structure_8_. + structure_8_both + structure_8_structured + 
##     structure_8_unstructured + structure_9_. + structure_9_both + 
##     structure_9_structured + structure_9_unstructured + structure_10_. + 
##     structure_10_both + structure_10_structured + structure_10_unstructured + 
##     structure_11_. + structure_11_both + structure_11_structured + 
##     structure_11_unstructured + structure_12_. + structure_12_both + 
##     structure_12_structured + structure_12_unstructured + structure_13_. + 
##     structure_13_both + structure_13_structured + structure_13_unstructured + 
##     structure_14_. + structure_14_both + structure_14_structured + 
##     structure_14_unstructured + structure_15_. + structure_15_both + 
##     structure_15_structured + structure_15_unstructured + structure_16_. + 
##     structure_16_both + structure_16_structured + structure_16_unstructured + 
##     structure_17_. + structure_17_both + structure_17_structured + 
##     structure_17_unstructured + structure_18_. + structure_18_both + 
##     structure_18_structured + structure_18_unstructured + structure_19_. + 
##     structure_19_both + structure_19_structured + structure_19_unstructured + 
##     structure_20_. + structure_20_both + structure_20_structured + 
##     structure_20_unstructured
##   #Df  LogLik Df  Chisq Pr(>Chisq)   
## 1  62 -799.34                        
## 2 106 -763.56 44 71.567   0.005376 **
## ---
## Signif. codes:  0 '***' 0.001 '**' 0.01 '*' 0.05 '.' 0.1 ' ' 1

Elastic net regression on all features

Position regression: detectability at 2-hr timepoint

## Warning: glm.fit: fitted probabilities numerically 0 or 1 occurred

New predictive model

Features:

  • Sequence: A/T vs. C/G (binary), with respect to spacer coordinates
  • Target viral structure: structured vs. unstructured (binary) from in vivo annotations
  • Spacer viral structure: number of base-paired positions in spacer

Comparison to screening performed in gBlocks

## Warning in eval(substitute(expr), data, enclos = parent.frame()): NAs introduced
## by coercion
## Warning: NAs introduced by coercion
## [1] "mixed model failed: NCR_1320"
## [1] "mixed model failed: NCR_1332"
## [1] "mixed model failed: NCR_1387"
## Warning: Removed 27 rows containing non-finite values (stat_smooth).
## Warning: Removed 27 rows containing missing values (geom_point).
## Warning: Removed 5 rows containing missing values (geom_smooth).

gBlock round 2 outlier: